=====FASTQ format=====


<WRAP center round box %0%>
@SEQ_ID

GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT

+

AAAAAAAAAAAAAAEEEEEEEEEEEEEEEEEEEEAAAAAAAAAAAAAAEEEEEAAEEEEE
</WRAP>



   *Line 1 (the header) begins with a '@' character and is followed by a sequence identifier and an optional description.
   *Line 2 is the raw sequence letters (the base calls; A, C, T, G and N).
   *Line 3 is a separator, which is simply a plus (+) sign.
   *Line 4 encodes the quality values for the sequence in Line 2, and must contain the same number of symbols as letters in the sequence.