meta data for this page
Differences
This shows you the differences between two versions of the page.
| Both sides previous revisionPrevious revisionNext revision | Previous revision | ||
| general:computerenvironment:shell_basic_commands [2019/12/01 22:20] – ruben | general:computerenvironment:shell_basic_commands [2020/09/07 18:20] (current) – [If / Else] ingo | ||
|---|---|---|---|
| Line 19: | Line 19: | ||
| Remember to call the file only in the first command given: | Remember to call the file only in the first command given: | ||
| cat ejemplo.txt | grep " | cat ejemplo.txt | grep " | ||
| + | |||
| + | ---- | ||
| + | Tip: You can create this file with: | ||
| + | < | ||
| + | nano ejemplo.txt | ||
| + | </ | ||
| + | paste the contents of the ejemplo file into the nano editor and close it using STRG/CMD + X | ||
| + | |||
| + | Alternatively you can download the file by clicking on its name and do the exercises in a linux environment on your local computer (for example using mobaXterm on windows, or in the command line on macOS). | ||
| + | ---- | ||
| + | |||
| ===== Reading files + counting lines ===== | ===== Reading files + counting lines ===== | ||
| Line 42: | Line 53: | ||
| </ | </ | ||
| + | ---- | ||
| + | |||
| + | ===== Tab completion ===== | ||
| + | |||
| + | You can auto-complete paths by pressing the tab key once or twice anytime while writing a path. If the auto-completion does not work, there might be something wrong with your path.. | ||
| + | |||
| + | You can check out [[https:// | ||
| ---- | ---- | ||
| Line 161: | Line 179: | ||
| If a directory does not exist, ' | If a directory does not exist, ' | ||
| <hidden Grep and quotations> | <hidden Grep and quotations> | ||
| + | Trying to find all ">" | ||
| + | <file txt important_sequence.fasta> | ||
| + | > | ||
| + | AAATTCTCACCCCTCAGAAA | ||
| + | > | ||
| + | ACCTCAGAAAAATTCTCACC | ||
| + | </ | ||
| < | < | ||
| - | echo -e $"> | ||
| - | cat important_sequence.fasta | ||
| grep > important_sequence.fasta | grep > important_sequence.fasta | ||
| </ | </ | ||
| Line 273: | Line 296: | ||
| * -lt = is lesser than | * -lt = is lesser than | ||
| - | [[general: | ||